Peritrich nuclear code
The peritrich nuclear code (translation table 30) is a genetic code used by the nuclear genome of the peritrich ciliates Vorticella and Opisthonecta.[1]
The code (30)
AAs = FFLLSSSSYYEECC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------*--------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (30) | Standard code (1) | |
|---|---|---|---|---|
| TAA | UAA | Glu (E) | Ter (*) | |
| TAG | UAG | Glu (E) | Ter (*) |
See also
- List of all genetic codes: translation tables 1 to 16, and 21 to 31.
- The genetic codes database.
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [2]
- ↑ Sánchez-Silva, Rocı́o; Villalobo, Eduardo; Morin, Loı̈c; Torres, Antonio (2003). "A New Noncanonical Nuclear Genetic Code". Current Biology. 13 (5): 442–447. doi:10.1016/s0960-9822(03)00126-x. PMID 12620196. S2CID 17484731.
- ↑ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 18 November 2016.