Haplogroup G-M201

Ancient G-M201s with sequencing Haplogroup G2a (G-P15) has been identified in Neolithic human remains in Europe dating between 5000 and 3000 BC. These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE.[9][10]

Furthermore, the majority of all the male skeletons from the European Neolithic period have so far yielded Y-DNA belonging to this haplogroup. The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in the Avellaner cave burial site, near Les Planes d'Hostoles, in Catalonia, Spain and were dated by radiocarbon dating to about 5000 BCE.[11]

A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. It was found with burial artifacts belonging to the Linearbandkeramische Kultur ("Linear Band Ceramic Culture"; LBK). This skeleton could not be dated by radiocarbon dating, but other skeletons there were dated to between 5,100 and 6,100 years old. The most detailed SNP mutation identified was S126 (L30), which defines G2a3.[12]

G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago.[13] The fourth site also from the same period is the Ötztal of the Italian Alps where the mummified remains of Ötzi the Iceman were discovered. The Iceman belongs to haplogroup G2a2b [14] (earlier called G2a4).

Haplogroup G2a2b is a rare group today in Europe. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers.

In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world – even though the average rate at the national level is about 1% or less. The Madjar and Argyn tribes (or clans) of Kazakhstan were found to possess the highest levels of G-M201 among any modern ethnic group. Amongst the Madjars, G1 was found at a rate of 87%. A separate study on the Argyns found that 71% of males belong to G1. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[15] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs.

In Turkey, the South Caucasus and Iran, haplogroup G reaches the highest percentage of national populations. Among Turkish males 11% of the population is G.[7] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities.[16] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 18% from Azerbaijan and 11% from Armenia appear to be G samples.

In Europe west of the Black Sea, Haplogroup G is found at about 5% of the population on average throughout most of the continent.[17] The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. There are seeming pockets of unusual concentrations within Europe. In Wales, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England.

In the Tirol (Tyrol) of western Austria, the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", Ötzi. In the northern and highland areas of the island of Sardinia off western Italy, G percentages reach 11% of the population in one study[18] and reached 21% in the town of Tempio in another study. In the Greek island of Crete, approximately 7%[19] to 11%[20] of males belong to haplogroup G. In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males.[21] The city is on the banks of the river Drava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G.

In South Asia, some ethnic minorities possess haplogroup G at concentrations of approximately 18%[22] to 20%[23] of Kalash, approximately 16% of Brahui,[23] and approximately 11.5% of sampled Pashtun,[22] but in only about 3% of the general Pakistani population.[22] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population.[24] About 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia.[25] Haplogroup G-M201 is believed to have been relatively absent during the Indian Neolithic period; the frequencies of the G2a-P15 subclade for example were negligible in indigenous Indian populations.[26]

In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas.[27][28] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[29]

Around 10% of Jewish males are Haplogroup G.

In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%.[30][31][32] 3% of North African Berbers were found to be haplogroup G.[33] 2% of Arab Moroccans and 0.8% of Berber Moroccans were likewise found to be G.[34]

In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. It is not found among Native Americans except where intermarriage with non-native persons has occurred. It has been found in Mexican mestizos.

Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. P15 was identified at the University of Arizona and became widely known by 2002. Its chromosome location listed as 21653414. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.[35]

There are multiple SNPs which so far have the same coverage as P15. They are—with accompanying Y-chromosome locations—U5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category.

Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. They are found only in tiny numbers elsewhere. So far all G2a1 persons have a value of 10 at STR marker DYS392. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons.

The North Ossetians in the mid northern Caucasus area of Russia belong overwhelmingly to the G2a1 subclade based on available samples. The South Ossetians and Svans generally south of North Ossetia have significant number of G2a1 persons, but population percentages have not yet been provided.

The presence of the SNP P18 mutation characterizes G2a1a's only subclade, G2a1a. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined.

Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters.

G-PF3147 (previously G-L223 and G-PF3146) is characterized by having the L223 mutation. L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223 was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. It was then learned that several subclades belong under L223, including:

G-L91 was identified in 2009. Its members include "Ötzi", [36] the so-called Iceman, who died at least 5,000 years BP in the European Alps. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The mutation involves a change from C to T.[37] L223 is found on the Y chromosome at rs13304806.

The G-M286 subclade (M286+) is small compared with G-L91. Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. The British samples have inconsistent double values for STR marker DYS19 in many cases. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A.

The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. The mutation is found on the Y chromosome at 10595022 and is a change from G to C.

G-L30 (also G-PF3267, G-S126 or G-U8; G2a2b, previously G2a3) Men who belong to this group but are negative for all its subclades represent a small number today. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture, known in German as Linearbandkeramik (LBK),[12] but was not tested for G2a3 subclades.

G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. G2a2b1 is more common in southern Europe than northern Europe. In Europe—except in Italy – G2a2b1 constitutes less than 20% of G samples. G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran.

A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a2b1 persons, and DYS392 is almost always 11. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1.

G-CTS2488 or G2a2b2 (also known as G-L141.1; previously G-141 and G2a3b) was identified only in mid-2009 at Family Tree DNA. Almost all L141 men belong to L141 subclades. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. L141 persons who do not belong to any L141 subclade so far have the value of 11 at STR marker DYS490 — a finding rare in other G categories. The L141 mutation is found on the Y chromosome at 2948607. The L141 mutation involves an insertion.[38]

G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. G2a2b2a is also found in India.

A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*

The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. There are additional subclades of DYS388=13 men characterized by the presence of specific SNPs or uncommon STR marker oddities. Members of this group have been found in Europe and the Middle East.[4]

The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). The G-L13 subclade is most common in north central Europe, and G-Z1266 is most common in the western Caucasus Mountains.

The final major subclade is characterized by presence of the SNP Z1903 and by a value of 9 at marker DYS568. A high percentage of G-Z1903 men belong to its subclade, G-Z724.

The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. This group has been linked with the Crypto-Jewish population which fled to the island during the time of the Spanish Inquisition, of which a significant portion are identifiable as G-Z725 (DYS388=13).[39]

G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. The SNP L177 (a.k.a. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp".[3][40]

Ancient DNA identified as G-PF3359 has been found at archaeological sites in: Hungary (the subclade G-F872*), dated at 7,500 years before present (BP); Hungary (subclade G-F1193*) 7,150 BP, and; Spain (G-PF3359*) 4,700 BP.[3]

The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. So far the men positive for this have had Irish, English, Dutch, Lebanese and/or Turkish (Armenian surname) ancestry. Several G-PF3359 subclades, based on shared STR markers, probably exist.

The number of STR marker values separating men in this group suggest G-PF3359 is a relatively old group despite the small number of men involved.[41] The mutations involved may be complicated and difficult to interpret.

G-M377, now also known as G2b1, has previously been designated G2b and G2c. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan.

The extreme rarity of G-M377 in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). These two reported Pakistani G-M377 haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. The Turkish G-M377 is somewhat closer, but not identical. It remains to be seen if testing will reveal G-M377 haplotypes in other populations — this is some indication that G-M377 occurs at low levels in the Near East.

All G-M377 men tested so far also have a rare null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event, a finding not yet seen among most other G haplotypes. Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study.[42]

Haplogroup G-M377 has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. This is likely due to a local founder effect.[43]